Truncated FRMD7 proteins in congenital Nystagmus: novel frameshift mutations and proteasomal pathway implications.

Idiopathic congenital nystagmus (ICN) manifests as involuntary and periodic eye movements. To identify the genetic defect associated with X-linked ICN, Whole Exome Sequencing (WES) was conducted in two affected families. We identified two frameshift mutations in FRMD7, c.1492dupT/p.(Y498Lfs*15) and c.1616delG/p.(R539Kfs*2). Plasmids harboring the mutated genes and qPCR analysis revealed mRNA stability, evading degradation via the NMD pathway, and corroborated truncated protein production via Western-blot analysis. Notably, both truncated proteins were degraded through the proteasomal (ubiquitination) pathway, suggesting potential therapeutic avenues targeting this pathway for similar mutations. Moreover, we conducted a comprehensive analysis, summarizing 140 mutations within the FRMD7 gene. Our findings highlight the FERM and FA structural domains as mutation-prone regions. Interestingly, exons 9 and 12 are the most mutated regions, but 90% (28/31) mutations in exon 9 are missense while 84% (21/25) mutations in exon 12 are frameshift. A predominant occurrence of shift code mutations was observed in exons 11 and 12, possibly associated with the localization of premature termination codons (PTCs), leading to the generation of deleterious truncated proteins. Additionally, our conjecture suggests that the loss of FRMD7 protein function might not solely drive pathology; rather, the emergence of aberrant protein function could be pivotal in nystagmus etiology. We propose a dependence of FRMD7 protein normal function primarily on its anterior domain. Future investigations are warranted to validate this hypothesis.

Best-corrected visual acuity results facilitate molecular diagnosis of infantile nystagmus patients harboring FRMD7 mutations.

The visual function of patients with infantile nystagmus (IN) can be significantly decreased owing to constant eye movement. While, reaching a definitive diagnosis becomes a challenge due to genetic heterozygous of this disease. To address it, we investigated whether best-corrected visual acuity (BCVA) results can facilitate the molecular diagnosis of IN patients harboring FRMD7 mutations. 200 patients with IN from 55 families and 133 sporadic cases were enrolled. Mutations were comprehensively screened by direct sequencing using gene-specific primers for FRMD7. We also retrieved related literature to verify the results based on our data. We found that the BCVA of patients with IN harboring FRMD7 mutations was between 0.5 and 0.7, which was confirmed by data retrieved from the literature. Our results showed that BCVA results facilitate the molecular diagnosis of patients with IN harboring FRMD7 mutations. In addition, we identified 31 FRMD7 mutations from the patients, including six novel mutations, namely, frameshift mutation c.1492_1493insT (p.Y498LfsTer14), splice-site mutation c.353C > G, three missense mutations [c.208C > G (p.P70A), c.234G > A (p.M78I), and c.1109G > A (p.H370R)], and nonsense mutation c.1195G > T (p.E399Ter). This study demonstrates that BCVA results may facilitate the molecular diagnosis of IN patients harboring FRMD7 mutations.

Micro chromosomal deletions at the NYS7 locus and autosomal dominant nystagmus.

Nystagmus is an ocular condition characterized by bilateral involuntary ocular oscillation which can severely affect vision. When not associated with other ocular or systemic diseases, it is referred to as idiopathic or congenital motor nystagmus (CMN). Genome-wide linkage studies have previously identified several loci associated with CMN, however the genes responsible for some of these loci have yet to be identified. We have examined a large, five-generation family with autosomal dominant CMN. Our purpose was to characterize the clinical manifestations and reveal the molecular basis of the disease in this family. In addition to full ophthalmic examination and imaging, molecular analysis included copy number variation analysis, linkage studies, and Sanger sequencing. Expression analyses of candidate genes was done by real-time PCR. Of the 68 family members, 27 subjects in five-generations had CMN, in line with an autosomal dominant inheritance pattern. Molecular analysis was performed on 27 members, 15 of them affected by CMN. Copy number variation analysis using array comparative genomic hybridization (aCGH) revealed a novel deletion located on 1q32 (NYS7) among affected individuals. Linkage analysis using polymorphic markers demonstrated full segregation with a heterozygous haplotype in all affected patients, with a LOD score of >5. Sanger sequencing of affected subjects revealed a novel deletion of 732,526 bp in the linkage interval. No protein-coding genes exist within the deleted region; however, the deletion disrupts topologically associated domains encompassing the gene NR5A2 and the non-protein coding MIR181A. Both are strongly associated with other genes expressed in the retina such as PROX1, which in turn is also associated with genes related to nystagmus such as PAX6. We therefore hypothesized that the deletion might affect NR5A2 and MIR181A expression, causing CMN. Expression analysis by real-time PCR showed significantly lower expression of NR5A2, and significantly higher expression of PROX1 among patients compared with controls. To conclude, among a large five-generation family with autosomal dominant CMN, a large deletion in the interval of NYS7 was linked with the disease. No protein-coding genes exist inside the deleted region, and so the exact mechanism in which CMN is caused is uncertain. Based on topological association and expression analyses we suggest a possible mechanism for the pathogenesis.

[Nystagmus in Children - a Survey]. / Nystagmus bei Kindern ­ eine Übersicht.

Nystagmus describes an involuntary, periodic movement of one or both eyes. About 1/600 children and adolescents have nystagmus, most of them idiopathic infantile nystagmus (IIN), also called "congenital nystagmus", which can be caused by mutations in the FRMD7 gene. Other frequent forms of nystagmus are latent nystagmus, which is usually associated with infantile strabismus, and nystagmus associated with albinism. Sometimes difficult to distinguish in young infants is a sensory nystagmus, where a defect in the visual system reduces vision and causes nystagmus. Causes include retinal dystrophies, congenital stationary night blindness and structural ocular defects including optic nerve hypoplasia or dense bilateral congenital cataracts. Unilateral nystagmus can be the sign of an anterior visual pathway lesion. Seesaw nystagmus may be associated with suprasellar and mesodiencephalic lesions and - rarely - with retinal dystrophies.The ophthalmology plays a key role in identifying the form of nystagmus. Children with new onset nystagmus, with spasmus nutans, with vertical or unilateral nystagmus and those with seesaw nystagmus require neurologic evaluation including imaging of the brain.The treatment of nystagmus depends on the underlying cause. Even minor refractive errors should be corrected, contact lenses offer advantages over glasses.Gabapentin and memantine, possibly also carbonic anhydrase inhibitors, are effective in treating IIN, nystagmus in albinism and sensory nystagmus. Nevertheless, pharmacologic treatment of nystagmus is rarely used in children; the reasons are the limited effects on vision, the need for lifelong therapy, and potential side effects. Eye muscle surgery (Anderson procedure, Kestenbaum procedure) can correct a nystagmus-related anomalous head posture. The concept of "artifical divergence" of Cüppers may help to decrease nystagmus intensity in patients whose nystagmus dampens with convergence. The four-muscle-tenotomy, which involves disinsertion and reinsertion of the horizontal muscles at the original insertion of both eyes, has a proven but limited positive effect on visual acuity.

FRMD7 Gene Alterations in a Pakistani Family Associated with Congenital Idiopathic Nystagmus.

Congenital idiopathic nystagmus (CIN) is an oculomotor disorder characterized by repetitive and rapid involuntary movement of the eye that usually develops in the first six months after birth. Unlike other forms of nystagmus, CIN is widely associated with mutations in the FRMD7 gene. This study involves the molecular genetic analysis of a consanguineous Pakistani family with individuals suffering from CIN to undermine any potential pathogenic mutations. Blood samples were taken from affected and normal individuals of the family. Genomic DNA was extracted using an in-organic method. Whole Exome Sequencing (WES) and analysis were performed to find any mutations in the causative gene. To validate the existence and co-segregation of the FRMD7 gene variant found using WES, sanger sequencing was also carried out using primers that targeted all of the FRMD7 coding exons. Additionally, the pathogenicity of the identified variant was assessed using different bioinformatic tools. The WES results identified a novel nonsense mutation in the FRMD7 (c.443T>A; p. Leu148 *) gene in affected individuals from the Pakistani family, with CIN resulting in a premature termination codon, further resulting in the formation of a destabilized protein structure that was incomplete. Co-segregation analysis revealed that affected males are hemizygous for the mutated allele c.443T>A; p. Leu148 * and the affected mother is heterozygous. Overall, such molecular genetic studies expand our current knowledge of the mutations associated with the FRMD7 gene in Pakistani families with CIN and significantly enhance our understanding of the molecular mechanisms involved in genetic disorders.

GPR143 mutations in an X-linked infantile nystagmus syndrome cohort in Southeast China.

Purpose: Infantile nystagmus syndrome (INS), or congenital nystagmus (CN), refers to a group of ocular motor disorders characterized by rapid to-and-fro oscillations of the eyes. GPR143 is the causative gene of ocular albinism type 1 (OA1), which is a special type of INS that manifests as reduced vision, nystagmus, and iris and fundus hypopigmentation. Here, we explored the genetic spectrum of INS and the genotype-phenotype correlation. Methods: A total of 98 families with INS from Southeast China were recruited for this study. A sample from each participant was subjected to PCR-based DNA direct sequencing of GPR143. Varied bioinformatics analysis was subsequently used in a mutation assessment. All participants received detailed ophthalmic examinations. Results: Genetic analysis identified 11 GPR143 mutations in 11.2% (11/98) of the X-linked INS families. These included seven novel mutations (c.899 C>T, c.886-2 A>G, c.1A>G, c.633_643del CCTGTTCCAAA, c.162_198delCGCGGGCCCCGGGTCCCCCGCGACGTCCCCGCCGGCC, c.628C>A, and c.178_179insGGGTCCC) and four known mutations. Patients who carried a GPR143 mutation were found to present a typical or atypical phenotype of OA1. All patients with GPR143 mutations manifested foveal hypoplasia; thus, about 45.8% (11/24) of the families with total X-linked INS exhibited foveal hypoplasia. Conclusions: We discovered seven novel mutations and four previously reported mutations of GPR143 in a cohort of families with X-linked INS and enlarged the Chinese genetic spectrum of INS. These findings offer new insights for developing genetic screening strategies and shed light on the importance of conducting genetic analysis in confirming the clinical diagnosis in unresolved patients and atypical phenotypes.

Noncanonical Splice Site and Deep Intronic FRMD7 Variants Activate Cryptic Exons in X-linked Infantile Nystagmus.

Purpose: We aim to report noncoding pathogenic variants in patients with FRMD7-related infantile nystagmus (FIN). Methods: Genome sequencing (n = 2 families) and reanalysis of targeted panel next generation sequencing (n = 2 families) was performed in genetically unsolved cases of suspected FIN. Previous sequence analysis showed no pathogenic coding variants in genes associated with infantile nystagmus. SpliceAI, SpliceRover, and Alamut consensus programs were used to annotate noncoding variants. Minigene splicing assay was performed to confirm aberrant splicing. In silico analysis of exonic splicing enhancer and silencer was also performed. Results: FRMD7 intronic variants were identified based on genome sequencing and targeted next-generation sequencing analysis. These included c.285-12A>G (pedigree 1), c.284+63T>A (pedigrees 2 and 3), and c. 383-1368A>G (pedigree 4). All variants were absent in gnomAD, and the both c.285-12A>G and c.284+63T>A variants were predicted to enhance new splicing acceptor gains with SpliceAI, SpliceRover, and Alamut consensus approaches. However, the c.383-1368 A>G variant only had a significant impact score on the SpliceRover program. The c.383-1368A>G variant was predicted to promote pseudoexon inclusion by binding of exonic splicing enhancer. Aberrant exonizations were validated through minigene constructs, and all variants were segregated in the families. Conclusions: Deep learning-based annotation of noncoding variants facilitates the discovery of hidden genetic variations in patients with FIN. This study provides evidence of effectiveness of combined deep learning-based splicing tools to identify hidden pathogenic variants in previously unsolved patients with infantile nystagmus. Translational Relevance: These results demonstrate robust analysis using two deep learning splicing predictions and in vitro functional study can lead to finding hidden genetic variations in unsolved patients.

Correlations of FRMD7 gene mutations with ocular oscillations.

Mutations in the FERM domain containing 7 (FRMD7) gene have been proven to be responsible for infantile nystagmus (IN). The purpose of this study is to investigate FRMD7 gene mutations in patients with IN, and to evaluate the nystagmus intensity among patients with and without FRMD7 mutations. The affected males were subdivided into three groups according to whether or not having FRMD7 mutations and the types of mutations. Fifty-two mutations were detected in FRMD7 in 56 pedigrees and 34 sporadic patients with IN, including 28 novel and 24 previous reported mutations. The novel identified mutations further expand the spectrum of FRMD7 mutations. The parameters of nystagmus intensity and the patients' best corrected visual acuity were not statistically different among the patients with and without identified FRMD7 mutations, and also not different among patients with different mutant types. The FERM-C domain, whose amino acids are encoded by exons 7, 8 and 9, could be the harbor region for most mutations. Loss-of-function is suggested to be the common molecular mechanism for the X-linked infantile nystagmus.

Infantile nystagmus without overt eye abnormality: Early features and neuro-ophthalmological diagnosis.

AIM: To analyse the neuro-ophthalmological data of children referred for further work-up of infantile nystagmus where ophthalmological evaluation had not achieved a diagnosis. METHOD: We retrospectively reviewed medical records of patients presenting with infantile nystagmus at our institution between 2007 and 2019. Inclusion criteria were onset before 6 months of age, availability of complete ophthalmic examination, visual electrophysiological tests, and neurological examination. Children with a previous definite ophthalmological diagnosis at onset and those with uncertain nystagmus onset age were not recruited. RESULTS: Out of 142 infants (mean age at nystagmus onset 3.6 mo, SD 1.7, range 0-6 mo; 56 females, 86 males), 23% had neurological nystagmus, 7% mixed neurological and sensory nystagmus, 48% sensory defect, and 22% idiopathic infantile nystagmus. The neurological diagnoses were inborn errors of metabolism, white matter genetic disorders, and brain malformations. The prevalent diagnosis in the sensory defect subgroup was retinal dystrophy. INTERPRETATION: Infantile nystagmus without diagnostic ocular findings may be due to neurological, retinal, and optic nerve disorders or be a benign idiopathic condition. In infants with and without neurological abnormalities, the search for a sensory defect should include visual electrophysiology performed early in the diagnostic pathway. WHAT THIS PAPER ADDS: Infantile nystagmus without diagnostic ophthalmological signs has an underlying neurological cause in 30% of cases. Neurological diagnoses include congenital brain malformations, and metabolic and genetic disorders. Sensory defects are part of systemic neurological disorders in 23% of infants. Electrophysiology is useful when ophthalmological examination is uninformative.

PhenoApt leverages clinical expertise to prioritize candidate genes via machine learning.

In recent years, exome sequencing (ES) has shown great utility in the diagnoses of Mendelian disorders. However, after rigorous filtering, a typical ES analysis still involves the interpretation of hundreds of variants, which greatly hinders the rapid identification of causative genes. Since the interpretations of ES data require comprehensive clinical analyses, taking clinical expertise into consideration can speed the molecular diagnoses of Mendelian disorders. To leverage clinical expertise to prioritize candidate genes, we developed PhenoApt, a phenotype-driven gene prioritization tool that allows users to assign a customized weight to each phenotype, via a machine-learning algorithm. Using the ability to rank causative genes in top-10 lists as an evaluation metric, baseline analysis demonstrated that PhenoApt outperformed previous phenotype-driven gene prioritization tools by a relative increase of 22.7%-140.0% in three independent, real-world, multi-center cohorts (cohort 1, n = 185; cohort 2, n = 784; and cohort 3, n = 208). Additional trials showed that, by adding weights to clinical indications, which should be explained by the causative gene, PhenoApt performance was improved by a relative increase of 37.3% in cohort 2 (n = 471) and 21.4% in cohort 3 (n = 208). Moreover, PhenoApt could assign an intrinsic weight to each phenotype based on the likelihood of its being a Mendelian trait using term frequency-inverse document frequency techniques. When clinical indications were assigned with intrinsic weights, PhenoApt performance was improved by a relative increase of 23.7% in cohort 2 and 15.5% in cohort 3. For the integration of PhenoApt into clinical practice, we developed a user-friendly website and a command-line tool.

GPR143 genotypic and ocular phenotypic characterisation in a Chinese cohort with ocular albinism.

PURPOSE: Ocular albinism type I (OA1) is caused by mutations in the GPR143 gene. The purpose of this study was to describe the clinical and genetic findings in 13 patients from 12 unrelated Chinese pedigrees with a pathogenic variant of the GPR143 gene. METHODS: Most patients underwent clinical examination, including best-corrected visual acuity (BCVA), slit-lamp biomicroscopy, fundus examination, spectral domain optical coherence tomography, and full-field electroretinograms (ERG). A combination of molecular screening procedures, consisting of Sanger-DNA sequencing of GPR143 and targeted next-generation sequencing, was performed to identify each mutation. In silico programs were utilized to evaluate the pathogenicity of all the variants. RESULTS: The 13 patients (mean age 21.75 ± 16.63 years, range 1-54 years) all presented with congenital nystagmus, different extents of visual impairment, and severe foveal hypoplasia. Their BCVA was between 0.05 and 0.3 (decimal notation). The patients and obligate carriers exhibited different extents of mild depigmentation of the iris and fundus. We detected 11 distinct mutations in this patient cohort, including 7 novel mutations. Most (82%) were null mutations and included frameshift indel, nonsense, splicing effect, and large genomic DNA deletions, while missense mutations only accounted for 18%. CONCLUSIONS: Patients with GPR143 mutations all have congenital nystagmus, visual impairment, and foveal hypoplasia, whereas hypopigmentation in their iris and fundus is mild. They exhibit no evident genotype-phenotype correlations. GPR143 mutation screening is very important for establishing a precise diagnosis and for providing genetic counseling for patients and their families.

Genotype-Phenotype of Isolated Foveal Hypoplasia in a Large Cohort: Minor Iris Changes as an Indicator of PAX6 Involvement.

Purpose: Foveal hypoplasia (FVH) is defined as the lack of fovea with a relatively preserved neuroretina, occurring either as an isolated FVH (IFVH) condition or associated with other diseases. This study aimed to systemically molecularly characterize IFVH. Methods: Genetic defects in 33 families with IFVH were analyzed by exome sequencing. Variants in three genes (PAX6, SLC38A8, and AHR) were selected and evaluated with multistep bioinformatic tools. Results: Mutations in the three genes were identified in 69.7% (23/33) of families with IFVH and infantile nystagmus, including 18 families with PAX6 mutations, 5 with SLC38A8 mutations, but none with AHR mutations. Clinical data from 32 patients in the 23 families showed FVH, infantile nystagmus, and full iris. Careful follow-up visits revealed subtle changes in iris in 9 of 14 patients with PAX6 variants. The PAX6 variants of the 18 families (15 missense and one stop-loss) were mostly located in the C-terminal region of the paired box domain. Variants in AHR, SLC38A8, and PAX6 contributed to IFVH in one (2%), 25 (45%), and 30 (53%) families with identified genetic defects (23 families in this study and 33 reported previously), respectively. Conclusions: PAX6 and SLC38A8 mutations are the main cause of IFVH based on our data and a systematic review. IFVH-associated PAX6 variants are mostly missense with a specific location, indicating a specific correlation of these variants with IFVH but not with typical aniridia. Full iris with subtle structural abnormalities is more common in patients with PAX6-associated IFVH, suggesting a potential diagnostic indicator.

Expanding the Phenotypic Spectrum of PAX6 Mutations: From Congenital Cataracts to Nystagmus.

BACKGROUND: Congenital aniridia is a complex ocular disorder, usually associated with severe visual impairment, generally caused by mutations on the PAX6 gene. The clinical phenotype of PAX6 mutations is highly variable, making the genotype-phenotype correlations difficult to establish. METHODS: we describe the phenotype of eight patients from seven unrelated families with confirmed mutations in PAX6, and very different clinical manifestations. RESULTS: Only two patients had the classical aniridia phenotype while the other two presented with aniridia-related manifestations, such as aniridia-related keratopathy or partial aniridia. Congenital cataracts were the main manifestation in three of the patients in this series. All the patients had nystagmus and low visual acuity. CONCLUSIONS: The diagnosis of mild forms of aniridia is challenging, but these patients have a potentially blinding hereditary disease that might present with a more severe phenotype in future generations. Clinicians should be aware of the mild aniridia phenotype and request genetic testing to perform an accurate diagnosis.

Longitudinal genotype-phenotype analysis in 86 patients with PAX6-related aniridia.

Aniridia is most commonly caused by haploinsufficiency of the PAX6 gene, characterized by variable iris and foveal hypoplasia, nystagmus, cataracts, glaucoma, and aniridia-related keratopathy (ARK). Genotype-phenotype correlations have previously been described; however, detailed longitudinal studies of aniridia are less commonly reported. We identified 86 patients from 62 unrelated families with molecularly confirmed heterozygous PAX6 variants from a UK-based single-center ocular genetics service. They were categorized into mutation groups, and a retrospective review of clinical characteristics (ocular and systemic) from baseline to most recent was recorded. One hundred and seventy-two eyes were evaluated, with a mean follow-up period of 16.3 ± 12.7 years. Nystagmus was recorded in 87.2% of the eyes, and foveal hypoplasia was found in 75%. Cataracts were diagnosed in 70.3%, glaucoma in 20.6%, and ARK in 68.6% of eyes. Prevalence, age of diagnosis and surgical intervention, and need for surgical intervention varied among mutation groups. Overall, the missense mutation subgroup had the mildest phenotype, and surgically naive eyes maintained better visual acuity. Systemic evaluation identified type 2 diabetes in 12.8% of the study group, which is twice the UK prevalence. This is the largest longitudinal study of aniridia in the UK, and as such, it can provide insights into prognostic indicators for patients and guiding clinical management of both ocular and systemic features.

Diagnostic yield of targeted next-generation sequencing in infantile nystagmus syndrome.

Background: Infantile nystagmus syndrome (INS) is a genetically heterogeneous disorder. Identifying genetic causes of INS would help clinicians to facilitate clinical diagnosis and provide appropriate treatment. The aim of this study was to determine the diagnostic utility of targeted next-generation sequencing (NGS) for INS.Materials and methods: We recruited 37 patients who were referred to the Neuro-ophthalmology clinics for evaluations of INS. NGS was performed using a targeted panel that included 98 candidate genes associated with INS. We identified pathogenic variants according to guidelines of the American College of Medical Genetics and Genomics. We also calculated the sensitivity and specificity of each clinical sign to assess the diagnostic yield of our gene panel.Results: After variant filtering, annotation, and interpretation, the potential pathogenic variants were detected in 13 of the 37 patients, achieving a molecular diagnostic rate of 35%. The identified genes were PAX6 (n = 4), FRMD7 (n = 4), GPR143 (n = 2), CACNA1F (n = 1), CNGA3 (n = 1) and GUCY2D (n = 1). In approximately 30% (n = 4) of the patients, the initial clinical diagnosis was revised after a molecular diagnosis was performed. The presence of a family history had the highest predictive power for a molecular diagnosis (sensitivity = 61.5%, specificity = 91.7%), and the sensitivity increased when the family history was considered together with one of two clinical signs such as pendular nystagmus waveforms or anterior segment dysgenesis.Conclusions: Our study shows that targeted NGS can be useful to determine a molecular diagnosis for patients with INS. Targeted NGS also helps to confirm a clinical diagnosis in atypical phenotypes or unresolved cases.

Biallelic mutations in L-dopachrome tautomerase (DCT) cause infantile nystagmus and oculocutaneous albinism.

Infantile nystagmus syndrome (INS) denominates early-onset, involuntary oscillatory eye movements with different etiologies. Nystagmus is also one of the symptoms in oculocutaneus albinism (OCA), a heterogeneous disease mainly caused by defects in melanin synthesis or melanosome biogenesis. Dopachrome tautomerase (DCT, also called TYRP2) together with tyrosinase (TYR) and tyrosin-related protein 1 (TYRP1) is one of the key enzymes in melanin synthesis. Although DCT´s role in pigmentation has been proven in different species, until now only mutations in TYR and TYRP1 have been found in patients with OCA. Detailed ophthalmological and orthoptic investigations identified a consanguineous family with two individuals with isolated infantile nystagmus and one family member with subtle signs of albinism. By whole-exome sequencing and segregation analysis, we identified the missense mutation c.176G > T (p.Gly59Val) in DCT in a homozygous state in all three affected family members. We show that this mutation results in incomplete protein maturation and targeting in vitro compatible with a partial or total loss of function. Subsequent screening of a cohort of patients with OCA (n = 85) and INS (n = 25) revealed two heterozygous truncating mutations, namely c.876C > A (p.Tyr292*) and c.1407G > A (p.Trp469*), in an independent patient with OCA. Taken together, our data suggest that mutations in DCT can cause a phenotypic spectrum ranging from isolated infantile nystagmus to oculocutaneous albinism.

TUBB3 M323V Syndrome Presents with Infantile Nystagmus.

Variants in the TUBB3 gene, one of the tubulin-encoding genes, are known to cause congenital fibrosis of the extraocular muscles type 3 and/or malformations of cortical development. Herein, we report a case of a 6-month-old infant with c.967A>G:p.(M323V) variant in the TUBB3 gene, who had only infantile nystagmus without other ophthalmological abnormalities. Subsequent brain magnetic resonance imaging (MRI) revealed cortical dysplasia. Neurological examinations did not reveal gross or fine motor delay, which are inconsistent with the clinical characteristics of patients with the M323V syndrome reported so far. A protein modeling showed that the M323V mutation in the TUBB3 gene interferes with αß heterodimer formation with the TUBA1A gene. This report emphasizes the importance of considering TUBB3 and TUBA1A tubulinopathy in infantile nystagmus. A brain MRI should also be considered for these patients, although in the absence of other neurologic signs or symptoms.

Genetic causes of nystagmus, foveal hypoplasia and subnormal visual acuity- other than albinism.

Background: To describe genetic molecular findings in individuals with congenital nystagmus, foveal hypoplasia, and subnormal vision, with normal ocular pigmentation (absence of diffuse transillumination or transparent retinal pigment typical for albinism).Methods: This is a retrospective, multicenter study of ophthalmic, systemic, and genetic features, as collected from medical records of patients diagnosed with infantile nystagmus and foveal hypoplasia. Ophthalmic findings include best-corrected visual acuity (BCVA), biomicroscopic examination, cycloplegic refraction, retinal examination, macular optical coherence tomography, and electroretinography. Genetic information was retrieved from the participating genetic clinics and included ethnicity and molecular diagnosis.Results: Thirty-one individuals met the inclusion criteria and had a secure molecular diagnosis. Mutations in two genes predominated, constituting 77.4% of all the represented genes: SLC38A8 (45.1%) and PAX6 (32.3%). Seventy-eight percent of the subjects who had a measurable BCVA had moderate and severe visual impairment (range 20/80 to 20/270). Most patients with a mutation in SLC38A8 had mild to moderate astigmatism, while most patients with PAX6 mutation had moderate and severe myopia. Patients in the PAX6 group had variable degrees of anterior segment manifestations.Conclusion: In our cohort, the main causative genes for congenital nystagmus and foveal hypoplasia in normally pigmented eyes were SLC38A8 and PAX6. A mild phenotype in PAX6 mutations may be an under-diagnosed cause of nystagmus and foveal hypoplasia. Reaching an accurate genetic diagnosis is essential for both the patients and their family members. This enables predicting disease prognosis, tailoring correct follow-up, and providing genetic counseling and family planning to affected families.

PAX6 missense variants in two families with isolated foveal hypoplasia and nystagmus: evidence of paternal postzygotic mosaicism.

PAX6 is considered the master regulator of eye development, the majority of variants affecting this gene cause the pan-ocular developmental eye disorder aniridia. Although no genotype-phenotype correlations are clearly established, missense variants affecting the DNA-binding paired domain of PAX6 are usually associated with non-aniridia phenotypes like microphthalmia, coloboma or isolated foveal hypoplasia. In this study, we report two missense heterozygous variants in the paired domain of PAX6 resulting in isolated foveal hypoplasia with nystagmus in two independent families: c.112 C > G; p.(Arg38Gly) and c.214 G > C; p.(Gly72Arg) in exons 5 and 6, respectively. Furthermore, we provide evidence that paternal postzygotic mosaicism is the cause of inheritance, with clinically unaffected fathers and reduced affected allele fraction. This work contributes to increase the phenotypic spectrum caused by PAX6 variants, and to our knowledge, is the first report to describe the presence of postzygotic parental mosaicism causing isolated foveal hypoplasia with nystagmus. These results support the growing evidence that suggest an overestimation of sporadic cases with PAX6 variants, which has strong implications for both genetic counselling and family planning.